ID: 996561051

View in Genome Browser
Species Human (GRCh38)
Location 5:124829842-124829864
Sequence GCTTCATTCTGCCCAGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996561051 Original CRISPR GCTTCATTCTGCCCAGCTAT AGG (reversed) Intergenic
900418206 1:2544664-2544686 GCTTGGGTCTGCCCAGCTGTGGG + Intergenic
901315014 1:8301156-8301178 GATTAATCCTGCCCAGCTACAGG - Intergenic
902662550 1:17915209-17915231 GATTCTCTCTGCCCAGCTCTGGG + Intergenic
905532669 1:38694510-38694532 ACTTCATTCTGCCCCTCTGTTGG - Intergenic
908986107 1:70023669-70023691 TCAACATTCTGCCCAACTATTGG - Intronic
909700909 1:78521905-78521927 GTTTCATGCTGCCAAGTTATAGG - Intronic
912926264 1:113915810-113915832 GCATCATTCTGTTCAGGTATAGG - Intergenic
913361936 1:117990249-117990271 GCTTCATTCAGCCCACAGATAGG - Intronic
917651252 1:177079604-177079626 GCTTCTTTCTGCCATGCCATTGG + Intronic
921071602 1:211663494-211663516 GCTTCACGCTGCCCAGCTGCGGG - Exonic
923044022 1:230341749-230341771 GCTGCATTTTGCCCAGTGATAGG - Intronic
924052298 1:240091809-240091831 GCTGCGTTCTGCGCAGCCATTGG + Intronic
1064002309 10:11673833-11673855 GCCTCATTTTGCCCAGCGTTTGG + Intergenic
1066702902 10:38148758-38148780 GCTTCATTATGGCCATCAATAGG + Intergenic
1067257949 10:44662336-44662358 GCTGCACTGTGTCCAGCTATAGG + Intergenic
1069831018 10:71282472-71282494 GTTTCCTTCTATCCAGCTATTGG + Intronic
1070729262 10:78814021-78814043 TCTTCATTCTGCCAACATATTGG - Intergenic
1073509580 10:104034761-104034783 TCTTCCTTCTGCCCAGCTGCCGG - Exonic
1075972834 10:126669346-126669368 GCTTCCTTCTGCCCAGCCTGGGG + Intronic
1076143637 10:128098925-128098947 GCTTCATTCTGCAAAGCTGAGGG + Exonic
1081686176 11:45044655-45044677 CCCTCACTCTGCCCAGCAATCGG + Intergenic
1083167680 11:60901116-60901138 TCCTCTTTCTGCCCAGCTGTGGG - Intronic
1084867566 11:72072185-72072207 GCTGCATTCTGCCTAGCGAGTGG - Intronic
1085961553 11:81468391-81468413 GAGTCATTGTCCCCAGCTATGGG + Intergenic
1089814717 11:121162194-121162216 GCTTCTTCCAGCCCTGCTATGGG + Exonic
1096961284 12:55580444-55580466 GCATCACTCTGAGCAGCTATAGG + Intergenic
1099444258 12:82733422-82733444 GCTTAATGCTGACCACCTATAGG - Intronic
1099716772 12:86304866-86304888 TCTTCCTTCTTCCCAGCTACTGG - Intronic
1101942316 12:109109005-109109027 GCTTTGTTTTGCCCAGCTGTAGG + Intronic
1103664435 12:122551854-122551876 ACATCTTTCTGCCCAACTATGGG - Intronic
1105503167 13:20989432-20989454 GCTGCATTCTGCCCAGCACAGGG + Intronic
1107654279 13:42575073-42575095 GTGTCATTCTGCCCACCCATTGG - Intronic
1110470302 13:75852775-75852797 GCTTGATTTTGCCCAACTGTAGG + Intronic
1114043180 14:18698707-18698729 GCTTCATGCTGCCCAGCTGCGGG - Intergenic
1114047470 14:18889153-18889175 GCTTCATGCTGCCCAGCTGCGGG - Intergenic
1114116743 14:19630255-19630277 GCTTCATGCTGCCCAGCTGCGGG + Intergenic
1114328209 14:21611128-21611150 TATTCATTCCTCCCAGCTATAGG - Intergenic
1114529746 14:23388331-23388353 GCTTCTTTCTGCCCAGGTGAGGG + Exonic
1119978734 14:79055445-79055467 GCCTCATTGTGACCAGCTAAGGG + Intronic
1120836446 14:89042096-89042118 ACTCCCTTCTGCCCAGCTACAGG - Intergenic
1122793135 14:104192836-104192858 TCGTCTTTCTGCCCAGCTCTTGG + Intergenic
1127360425 15:58240391-58240413 TCTTCCTTCTGCCCAGCAATTGG - Intronic
1131449657 15:92528741-92528763 GCTTGTTTCTACACAGCTATAGG + Intergenic
1131617664 15:94033742-94033764 GCAAAATTCTGCCCAGCTGTGGG - Intergenic
1131806385 15:96126763-96126785 TCTGCATGCTGCCCAGATATGGG + Intergenic
1134903006 16:17955634-17955656 GCTTCATGCAGCCCAGGTTTTGG - Intergenic
1135662288 16:24307048-24307070 CCCTCATACTGCCCAGCTATTGG - Intronic
1136586842 16:31191828-31191850 GCCTAAATTTGCCCAGCTATGGG + Exonic
1136995960 16:35188159-35188181 GCCTCATTCAGCCCAGGTAGGGG + Intergenic
1139197623 16:64939248-64939270 GCTTTATTCTGCCCGGATACAGG - Intergenic
1141628831 16:85275923-85275945 GCCTCATGCTGCAGAGCTATAGG + Intergenic
1153863275 18:9235216-9235238 GCATCATTATGCCTAGCTATTGG - Intronic
1155323003 18:24637387-24637409 ACTTCATTCTGGCCTGCTAATGG - Intergenic
1157169484 18:45389165-45389187 GCACCTTTCTGACCAGCTATTGG + Intronic
1159921135 18:74228273-74228295 GCCTCATTCAGCCCAGCTGCAGG + Intergenic
1161453565 19:4359585-4359607 GACTCATTCTGCTCAGCTCTCGG + Intronic
1162916521 19:13877231-13877253 GGCACATGCTGCCCAGCTATGGG + Exonic
1164136630 19:22422478-22422500 TCTTCATTCAGCCCAGCATTTGG - Intronic
930412012 2:51036255-51036277 GCTTCATTTTGATCATCTATAGG - Intergenic
938424848 2:131177681-131177703 GCTTCATGCTGCCCAGCTGCGGG - Intronic
942991767 2:182210282-182210304 GCTCCATTCTCACCAGCTTTTGG + Intronic
947404595 2:229761828-229761850 GCTCCAGTCTTCCCAGCTAGGGG - Intergenic
1170899766 20:20450645-20450667 GCTTCACTCTCCCCATCTGTGGG + Intronic
1173233973 20:41226845-41226867 GCTTCATTCTGCTCAGACCTGGG - Intronic
1174499782 20:50976099-50976121 GCTCCACTCTGCCCTGCTCTTGG - Intergenic
1176136114 20:63522688-63522710 GCATCATTCTGGCCTGGTATAGG + Intergenic
1180466004 22:15611824-15611846 GCTTCATGCTGCCCAGCTGCGGG - Intergenic
1183933022 22:41246877-41246899 CCTTCATTCTGGCCAGCTCTGGG - Intronic
1184098470 22:42329291-42329313 GCTTCCATCCGCCCAGCTGTGGG + Intronic
1184711895 22:46255428-46255450 ACTACATTCTGCCCAGGTCTAGG + Intergenic
951704819 3:25533640-25533662 CTTTCATTCTGCCCAGTCATTGG + Intronic
952175547 3:30858805-30858827 GCTCCTTTCTGCCCTGCTGTAGG - Intronic
952423335 3:33150654-33150676 GCTTTATTTTACCCAACTATGGG + Exonic
952899264 3:38098818-38098840 GTTTCAGAGTGCCCAGCTATAGG - Intronic
956234679 3:67055897-67055919 ACTTCTTTCTGCAGAGCTATCGG + Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
962497861 3:135961043-135961065 GCACCATTATACCCAGCTATTGG + Intergenic
968612843 4:1564879-1564901 GCATCATCCTCCCCAGCTGTGGG + Intergenic
969827287 4:9767513-9767535 GCTTCCTTCCTCCCAGGTATGGG - Intergenic
973587431 4:52407552-52407574 GCATCATTTTGCCCAGCCTTAGG - Intergenic
974241147 4:59249116-59249138 GCCTCAATTTGCTCAGCTATAGG - Intergenic
980066289 4:128192502-128192524 GCTAGATTTTGCCCAACTATAGG - Intronic
981229941 4:142340753-142340775 GCTTTATTCTTCCCCTCTATGGG + Intronic
981238788 4:142449928-142449950 GCTTCAGTCTCTCCAGCAATTGG + Intronic
981900600 4:149857492-149857514 TCTTAATTCTGCCAACCTATAGG + Intergenic
988778817 5:34500743-34500765 GCTTCATTGAGCCCATCTTTTGG - Intergenic
990484758 5:56247212-56247234 CCTTCTGTCTGCCCAGTTATGGG - Intergenic
993729990 5:91410951-91410973 CCTTCATTCTGCCCTGCAAAAGG - Intergenic
993830386 5:92749844-92749866 GATTCTTTCTGCCCAGATTTGGG + Intergenic
996561051 5:124829842-124829864 GCTTCATTCTGCCCAGCTATAGG - Intergenic
1001985581 5:176072502-176072524 TCTTCATTGTGCCCAGCTCGGGG + Intronic
1002231291 5:177765622-177765644 TCTTCATTGTGCCCAGCTCGGGG - Intronic
1002264047 5:178018126-178018148 TCTTCATTGTGCCCAGCTCGGGG + Intronic
1003414893 6:5898749-5898771 CCTTCATTGAGCCCAGCTCTGGG + Intergenic
1003852851 6:10242566-10242588 GCTTCAGTTTGCCCAGCTTTGGG - Intergenic
1008133400 6:47743959-47743981 GTGGCATTCTGCCCAGCTAGTGG - Intergenic
1012518696 6:100093666-100093688 GCTTCTCTCTGCCCAGCTCCAGG + Intergenic
1012772242 6:103453119-103453141 TCTTCATTCAGCCCAGCGACTGG + Intergenic
1013438533 6:110138486-110138508 GCTTCATTCTTCCCAGACGTGGG - Intronic
1017647086 6:156549091-156549113 AATTTATTCTACCCAGCTATGGG + Intergenic
1019009733 6:168834392-168834414 GCTTCACCCTGCCCAGCTGCAGG + Intergenic
1024365460 7:48515537-48515559 GCTTCTTACTCCCCAGCTTTGGG + Intronic
1028846817 7:95490751-95490773 GCAGCTTTCTACCCAGCTATTGG + Intronic
1028874046 7:95800602-95800624 GCTTCACTCTACCCAGATTTAGG - Intronic
1029750147 7:102538640-102538662 GGTTAATTCTGCCCAGCCAGTGG - Intronic
1029768098 7:102637748-102637770 GGTTAATTCTGCCCAGCCAGTGG - Intronic
1031984417 7:128154010-128154032 GCGTCATTCTCCCCAGGTTTTGG + Intergenic
1033387318 7:140890804-140890826 GCTTCCTTTTGCTCAGATATGGG - Intronic
1035436712 7:158864971-158864993 GCTGGAGTCTGCCCAGCTGTCGG + Intronic
1036912040 8:12765719-12765741 CCCTGATTCTGCCCAGCCATGGG + Intergenic
1037816926 8:22117266-22117288 GATTCAGTCTGCCCAACTGTAGG - Intronic
1039131939 8:34274974-34274996 GCTACATGCTGCCCAGCTTTTGG + Intergenic
1039403433 8:37292757-37292779 GCTCCACTCTGCCCAGGAATTGG + Intergenic
1039886991 8:41660459-41660481 CCTTCATGCTGCCCAGCTCGGGG - Intronic
1045844690 8:106620106-106620128 GCTTCATTGTACCCATCCATAGG + Intronic
1046022514 8:108682132-108682154 GGTTCATTATGCTCAGGTATTGG + Intronic
1046175516 8:110570800-110570822 GCTATATTCTGCAAAGCTATAGG - Intergenic
1047825100 8:128564827-128564849 GCTACATTTTACCCAGATATTGG + Intergenic
1048022311 8:130550590-130550612 CCTTCATCCTCCCCAGCCATAGG - Intergenic
1050774876 9:9247206-9247228 CCTTCCTTCTTCCCAGGTATAGG - Intronic
1052455082 9:28686083-28686105 CTTTCTTTCTGCCCAGATATGGG + Intergenic
1054820094 9:69513684-69513706 ACTTCATTCTCCCCAGCAAGGGG - Intronic
1059964038 9:119595978-119596000 CCTGCATGCTGCCCAGATATGGG + Intergenic
1186007474 X:5088705-5088727 ACTTCATTCTCTCCAGCTATAGG - Intergenic
1186857353 X:13639075-13639097 GCCTCAGTCTGGCCAGCTACAGG - Intergenic
1187360278 X:18619746-18619768 GTTTGATTCTTCCCGGCTATAGG + Intronic
1194137082 X:90158685-90158707 GATTAATTCATCCCAGCTATGGG - Intergenic
1198433306 X:136589493-136589515 GCTTCCTTCATCCCAGCTAAAGG - Intergenic
1199616344 X:149659066-149659088 GCCTCAGTCTGCCCAGCTTGGGG + Intergenic
1199626297 X:149744182-149744204 GCCTCAGTCTGCCCAGCTTGGGG - Intergenic
1201507789 Y:14723204-14723226 GCAGCATTTTGGCCAGCTATGGG + Exonic
1201673146 Y:16548645-16548667 ACTTCATTCTTTCCAGCTATAGG + Intergenic