ID: 996562211

View in Genome Browser
Species Human (GRCh38)
Location 5:124843096-124843118
Sequence AGGTGGTTAAGGAGCGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996562198_996562211 19 Left 996562198 5:124843054-124843076 CCGTGAGTTACGGTAAAATCAAG No data
Right 996562211 5:124843096-124843118 AGGTGGTTAAGGAGCGAGGAGGG No data
996562197_996562211 20 Left 996562197 5:124843053-124843075 CCCGTGAGTTACGGTAAAATCAA No data
Right 996562211 5:124843096-124843118 AGGTGGTTAAGGAGCGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996562211 Original CRISPR AGGTGGTTAAGGAGCGAGGA GGG Intergenic
No off target data available for this crispr