ID: 996563467

View in Genome Browser
Species Human (GRCh38)
Location 5:124855646-124855668
Sequence TAGGACCTCCACATTGACCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996563467_996563468 -8 Left 996563467 5:124855646-124855668 CCATGGTCAATGTGGAGGTCCTA No data
Right 996563468 5:124855661-124855683 AGGTCCTATGTCTTTTAAAGTGG No data
996563467_996563470 17 Left 996563467 5:124855646-124855668 CCATGGTCAATGTGGAGGTCCTA No data
Right 996563470 5:124855686-124855708 AATGAGTATTTAAATATTTGAGG No data
996563467_996563471 18 Left 996563467 5:124855646-124855668 CCATGGTCAATGTGGAGGTCCTA No data
Right 996563471 5:124855687-124855709 ATGAGTATTTAAATATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996563467 Original CRISPR TAGGACCTCCACATTGACCA TGG (reversed) Intergenic
No off target data available for this crispr