ID: 996568707

View in Genome Browser
Species Human (GRCh38)
Location 5:124909429-124909451
Sequence CTTCAAAGGCAGAGCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996568702_996568707 5 Left 996568702 5:124909401-124909423 CCTTTTGTACTAATGCACTGACC No data
Right 996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG No data
996568700_996568707 25 Left 996568700 5:124909381-124909403 CCAGTGTACTGGATTAATTCCCT No data
Right 996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG No data
996568701_996568707 6 Left 996568701 5:124909400-124909422 CCCTTTTGTACTAATGCACTGAC No data
Right 996568707 5:124909429-124909451 CTTCAAAGGCAGAGCCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996568707 Original CRISPR CTTCAAAGGCAGAGCCTGGA TGG Intergenic
No off target data available for this crispr