ID: 996571277

View in Genome Browser
Species Human (GRCh38)
Location 5:124934727-124934749
Sequence CAGCCTTAATGCCCCAAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996571274_996571277 10 Left 996571274 5:124934694-124934716 CCTAGCACTATTTGTTATATTAA No data
Right 996571277 5:124934727-124934749 CAGCCTTAATGCCCCAAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996571277 Original CRISPR CAGCCTTAATGCCCCAAATT AGG Intergenic
No off target data available for this crispr