ID: 996575455

View in Genome Browser
Species Human (GRCh38)
Location 5:124972836-124972858
Sequence GAAGATGGCCCCTTCTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996575446_996575455 18 Left 996575446 5:124972795-124972817 CCTTCAGGCCATCAAATTCCAAA No data
Right 996575455 5:124972836-124972858 GAAGATGGCCCCTTCTTCTGGGG No data
996575448_996575455 10 Left 996575448 5:124972803-124972825 CCATCAAATTCCAAACAGGCAAC No data
Right 996575455 5:124972836-124972858 GAAGATGGCCCCTTCTTCTGGGG No data
996575449_996575455 0 Left 996575449 5:124972813-124972835 CCAAACAGGCAACCAGAGCCTCT No data
Right 996575455 5:124972836-124972858 GAAGATGGCCCCTTCTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996575455 Original CRISPR GAAGATGGCCCCTTCTTCTG GGG Intergenic
No off target data available for this crispr