ID: 996577949

View in Genome Browser
Species Human (GRCh38)
Location 5:124997389-124997411
Sequence ATTTCAGGAGGAAATGTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996577949_996577953 -1 Left 996577949 5:124997389-124997411 CCATCTACATTTCCTCCTGAAAT No data
Right 996577953 5:124997411-124997433 TTTGCAGGTCCTGAGTAATATGG No data
996577949_996577955 17 Left 996577949 5:124997389-124997411 CCATCTACATTTCCTCCTGAAAT No data
Right 996577955 5:124997429-124997451 TATGGAATAAAAGTTTAATGTGG No data
996577949_996577956 22 Left 996577949 5:124997389-124997411 CCATCTACATTTCCTCCTGAAAT No data
Right 996577956 5:124997434-124997456 AATAAAAGTTTAATGTGGTTTGG No data
996577949_996577957 29 Left 996577949 5:124997389-124997411 CCATCTACATTTCCTCCTGAAAT No data
Right 996577957 5:124997441-124997463 GTTTAATGTGGTTTGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996577949 Original CRISPR ATTTCAGGAGGAAATGTAGA TGG (reversed) Intergenic
No off target data available for this crispr