ID: 996577954

View in Genome Browser
Species Human (GRCh38)
Location 5:124997420-124997442
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996577954_996577957 -2 Left 996577954 5:124997420-124997442 CCTGAGTAATATGGAATAAAAGT No data
Right 996577957 5:124997441-124997463 GTTTAATGTGGTTTGGCTTCAGG No data
996577954_996577956 -9 Left 996577954 5:124997420-124997442 CCTGAGTAATATGGAATAAAAGT No data
Right 996577956 5:124997434-124997456 AATAAAAGTTTAATGTGGTTTGG No data
996577954_996577958 6 Left 996577954 5:124997420-124997442 CCTGAGTAATATGGAATAAAAGT No data
Right 996577958 5:124997449-124997471 TGGTTTGGCTTCAGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996577954 Original CRISPR ACTTTTATTCCATATTACTC AGG (reversed) Intergenic
No off target data available for this crispr