ID: 996577957

View in Genome Browser
Species Human (GRCh38)
Location 5:124997441-124997463
Sequence GTTTAATGTGGTTTGGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996577949_996577957 29 Left 996577949 5:124997389-124997411 CCATCTACATTTCCTCCTGAAAT No data
Right 996577957 5:124997441-124997463 GTTTAATGTGGTTTGGCTTCAGG No data
996577954_996577957 -2 Left 996577954 5:124997420-124997442 CCTGAGTAATATGGAATAAAAGT No data
Right 996577957 5:124997441-124997463 GTTTAATGTGGTTTGGCTTCAGG No data
996577951_996577957 17 Left 996577951 5:124997401-124997423 CCTCCTGAAATTTGCAGGTCCTG No data
Right 996577957 5:124997441-124997463 GTTTAATGTGGTTTGGCTTCAGG No data
996577952_996577957 14 Left 996577952 5:124997404-124997426 CCTGAAATTTGCAGGTCCTGAGT No data
Right 996577957 5:124997441-124997463 GTTTAATGTGGTTTGGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996577957 Original CRISPR GTTTAATGTGGTTTGGCTTC AGG Intergenic
No off target data available for this crispr