ID: 996578423

View in Genome Browser
Species Human (GRCh38)
Location 5:125001852-125001874
Sequence CTGGAGGTTCCAGCATTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996578423_996578430 19 Left 996578423 5:125001852-125001874 CCAACAAATGCTGGAACCTCCAG No data
Right 996578430 5:125001894-125001916 GGATATGTGTCATTTTACAACGG No data
996578423_996578428 -2 Left 996578423 5:125001852-125001874 CCAACAAATGCTGGAACCTCCAG No data
Right 996578428 5:125001873-125001895 AGGATTACTTGGTCCTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996578423 Original CRISPR CTGGAGGTTCCAGCATTTGT TGG (reversed) Intergenic
No off target data available for this crispr