ID: 996578430

View in Genome Browser
Species Human (GRCh38)
Location 5:125001894-125001916
Sequence GGATATGTGTCATTTTACAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996578423_996578430 19 Left 996578423 5:125001852-125001874 CCAACAAATGCTGGAACCTCCAG No data
Right 996578430 5:125001894-125001916 GGATATGTGTCATTTTACAACGG No data
996578427_996578430 0 Left 996578427 5:125001871-125001893 CCAGGATTACTTGGTCCTTTATA No data
Right 996578430 5:125001894-125001916 GGATATGTGTCATTTTACAACGG No data
996578426_996578430 3 Left 996578426 5:125001868-125001890 CCTCCAGGATTACTTGGTCCTTT No data
Right 996578430 5:125001894-125001916 GGATATGTGTCATTTTACAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996578430 Original CRISPR GGATATGTGTCATTTTACAA CGG Intergenic
No off target data available for this crispr