ID: 996579411

View in Genome Browser
Species Human (GRCh38)
Location 5:125014613-125014635
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996579408_996579411 -3 Left 996579408 5:125014593-125014615 CCTTGTAAGTAAGAAGCAAATTA No data
Right 996579411 5:125014613-125014635 TTAGGTTACCTGTCCATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr