ID: 996579582

View in Genome Browser
Species Human (GRCh38)
Location 5:125016231-125016253
Sequence TTAAGCTTGCCTAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996579577_996579582 7 Left 996579577 5:125016201-125016223 CCAGCCAGGCTTTTTTTTTTCCT No data
Right 996579582 5:125016231-125016253 TTAAGCTTGCCTAGGGAAGCTGG No data
996579578_996579582 3 Left 996579578 5:125016205-125016227 CCAGGCTTTTTTTTTTCCTACTT No data
Right 996579582 5:125016231-125016253 TTAAGCTTGCCTAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996579582 Original CRISPR TTAAGCTTGCCTAGGGAAGC TGG Intergenic
No off target data available for this crispr