ID: 996585261

View in Genome Browser
Species Human (GRCh38)
Location 5:125080451-125080473
Sequence AATCATACACCTAGATGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996585261_996585263 13 Left 996585261 5:125080451-125080473 CCATACCATCTAGGTGTATGATT No data
Right 996585263 5:125080487-125080509 ATCGCTAATGATGCTTTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996585261 Original CRISPR AATCATACACCTAGATGGTA TGG (reversed) Intergenic
No off target data available for this crispr