ID: 996585262

View in Genome Browser
Species Human (GRCh38)
Location 5:125080456-125080478
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996585262_996585263 8 Left 996585262 5:125080456-125080478 CCATCTAGGTGTATGATTGTACA No data
Right 996585263 5:125080487-125080509 ATCGCTAATGATGCTTTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996585262 Original CRISPR TGTACAATCATACACCTAGA TGG (reversed) Intergenic
No off target data available for this crispr