ID: 996585263

View in Genome Browser
Species Human (GRCh38)
Location 5:125080487-125080509
Sequence ATCGCTAATGATGCTTTTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996585261_996585263 13 Left 996585261 5:125080451-125080473 CCATACCATCTAGGTGTATGATT No data
Right 996585263 5:125080487-125080509 ATCGCTAATGATGCTTTTCTCGG No data
996585262_996585263 8 Left 996585262 5:125080456-125080478 CCATCTAGGTGTATGATTGTACA No data
Right 996585263 5:125080487-125080509 ATCGCTAATGATGCTTTTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996585263 Original CRISPR ATCGCTAATGATGCTTTTCT CGG Intergenic
No off target data available for this crispr