ID: 996585565

View in Genome Browser
Species Human (GRCh38)
Location 5:125084200-125084222
Sequence AGATGCAATCAGAGACATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996585565_996585567 11 Left 996585565 5:125084200-125084222 CCCAGATGTCTCTGATTGCATCT No data
Right 996585567 5:125084234-125084256 AGTTCTTTGCTCATCTTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996585565 Original CRISPR AGATGCAATCAGAGACATCT GGG (reversed) Intergenic
No off target data available for this crispr