ID: 996591189

View in Genome Browser
Species Human (GRCh38)
Location 5:125149532-125149554
Sequence TTGTGGTTCTTCAAATGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996591189_996591194 14 Left 996591189 5:125149532-125149554 CCGCCACATTTGAAGAACCACAA 0: 1
1: 0
2: 1
3: 19
4: 144
Right 996591194 5:125149569-125149591 AGCTGAAAGAAATACACAAGTGG 0: 1
1: 0
2: 3
3: 29
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996591189 Original CRISPR TTGTGGTTCTTCAAATGTGG CGG (reversed) Intergenic
900309384 1:2025979-2026001 TTTTGGTTTTTAAAATGGGGTGG + Intronic
904916911 1:33976899-33976921 TTTAGGTTCTTCAAGTGTCGTGG + Intronic
904996724 1:34637127-34637149 TTGTGGTTCTTCAATTGATATGG - Intergenic
907466852 1:54643697-54643719 TTGTAGGTGTTCAAATGTTGGGG - Intronic
908634434 1:66146680-66146702 GTGTGATGCTTGAAATGTGGTGG - Intronic
912338912 1:108890690-108890712 ATCTGGTTCTTCCATTGTGGAGG + Intronic
912482235 1:109992058-109992080 TTGTGGTTCCAGAAATCTGGGGG + Intronic
916338827 1:163705221-163705243 TTATGGTTCATCTAATGTTGTGG + Intergenic
919076054 1:192814145-192814167 TTGTGGTTCCTACAATTTGGTGG - Intergenic
920053467 1:203176927-203176949 TTGTAATTGTTGAAATGTGGGGG + Intergenic
922340486 1:224650982-224651004 GTGTGGTTGTTCACATGGGGAGG + Intronic
1063323802 10:5077157-5077179 ACGTGGTTTTTCCAATGTGGAGG - Intronic
1065038679 10:21667345-21667367 TTGAGGTTCTTAAACTGTGGGGG + Intronic
1068040884 10:51822887-51822909 TGGTGGTTCTTCTAAACTGGTGG + Intronic
1073668794 10:105563702-105563724 TTGTGGTTCTTTGAATATTGAGG + Intergenic
1075653276 10:124144060-124144082 GTGTCCTTCTTCATATGTGGTGG + Intergenic
1079961440 11:26928963-26928985 TTGTAGTTCACCAAGTGTGGTGG + Intergenic
1089783716 11:120893030-120893052 TTGGGGTTACTGAAATGTGGAGG - Intronic
1091256712 11:134194240-134194262 TTGTGGTTCTTAACATTTTGGGG + Intronic
1101339752 12:103832349-103832371 TTCTGATTCCTAAAATGTGGAGG - Intronic
1103022663 12:117548605-117548627 ATGTGGATTTTCAACTGTGGGGG + Intronic
1103607815 12:122099976-122099998 TCCTGGCTCTTCAAATGTCGGGG - Intronic
1107671471 13:42750506-42750528 CTTTGGTTCTTCAAGTGGGGAGG + Intergenic
1109540696 13:63775413-63775435 TTGGGATTCTTCAACTGAGGTGG - Intergenic
1113918568 13:113889914-113889936 TTCTGGTCCTCAAAATGTGGAGG - Intergenic
1118514608 14:66511363-66511385 TTGTGGCTCTTAAAAGGTGGAGG + Intronic
1118543094 14:66853045-66853067 CTGTGGTTCTTCATTTGTGGAGG - Intronic
1124003456 15:25778353-25778375 TTGTGGTTTTTCAATTGCTGGGG + Intronic
1126687543 15:51261547-51261569 GTGTGTTTCTTCAAATGTATGGG + Intronic
1131311633 15:91296002-91296024 CTGTGGATTTCCAAATGTGGTGG + Exonic
1133708202 16:8375757-8375779 TGATGGTTCCTCAGATGTGGAGG + Intergenic
1134678359 16:16106242-16106264 TTCTTGTTTTACAAATGTGGTGG - Intronic
1138136167 16:54524804-54524826 ATTTGGCTCTTCAAATATGGAGG + Intergenic
1140111297 16:72007838-72007860 TTGTGGTGCAACAGATGTGGAGG - Intergenic
1140330232 16:74049396-74049418 TAGTGGTTGTTGAGATGTGGTGG - Intergenic
1141477326 16:84282659-84282681 TTGTGCTGCTGCAGATGTGGGGG + Intergenic
1142244445 16:88963105-88963127 GGGTGCTTCTTCAAATCTGGAGG + Intronic
1147510685 17:41066408-41066430 TTGTGGTTTTTCATATGAGCAGG + Intergenic
1148960242 17:51386310-51386332 CTGTCGTTCAACAAATGTGGGGG - Intergenic
1149959583 17:61093300-61093322 TTGTGGGTGGTCAAGTGTGGTGG + Intronic
1149974330 17:61250933-61250955 TTGTGGTACTTCACATGAGCGGG + Intronic
1150943311 17:69717139-69717161 TTGTGGTGCTTCTAAAATGGGGG + Intergenic
1152704439 17:81835414-81835436 CTGTGCTTCTGCAGATGTGGAGG - Intergenic
1155671904 18:28381550-28381572 AAATGGTTCTTCAAATGTGAAGG + Intergenic
1158020286 18:52833618-52833640 TGGTGGTTCTCAAAATGTGGTGG - Intronic
1158020363 18:52834316-52834338 TGGTGATTCTCAAAATGTGGTGG + Intronic
1158300669 18:56048361-56048383 ATGTGTTTCATCAAATCTGGAGG - Intergenic
1158618107 18:59006152-59006174 TTAAGGATCTTAAAATGTGGGGG + Intergenic
1159115563 18:64109039-64109061 CAGTGATTTTTCAAATGTGGGGG - Intergenic
1162715432 19:12628715-12628737 TTGTGGATTTTCAAATCTAGAGG - Exonic
1165560251 19:36672821-36672843 TTGTGGTTCTTTAACTGGTGGGG - Intergenic
1165729525 19:38135773-38135795 TTGTTGTTCTTCAAATGCAGAGG + Intronic
1167809045 19:51812571-51812593 TTGTGTTTCTTCAGAGGTGGAGG - Intronic
928336994 2:30406693-30406715 CTGTGTGTCTTCAAATGTGTAGG - Intergenic
928626859 2:33148838-33148860 TTTTGGTTATTCAAATTTGGGGG + Intronic
929373972 2:41261458-41261480 TTGTGACTCTTCAAATCTTGGGG - Intergenic
930146063 2:48005810-48005832 TTTGGGTTCTTCAAATTTTGGGG + Intergenic
934095316 2:88596651-88596673 TTGTGGTTTTTCAAACATGATGG - Intronic
934583856 2:95471316-95471338 CTGTGGTTCTTGCAATTTGGGGG + Intergenic
934595596 2:95605398-95605420 CTGTGGTTCTTGCAATTTGGGGG - Intergenic
934787177 2:97020087-97020109 CTGTGGTTCTTGCAATTTGGGGG + Intergenic
936667864 2:114618500-114618522 GTGTGTTTCCTGAAATGTGGTGG - Intronic
940081370 2:149806071-149806093 TTGTGGCTTTTCAATTTTGGAGG - Intergenic
940268332 2:151863622-151863644 TCTTGGTTCTTCAAATCTGAAGG + Intronic
940516324 2:154687888-154687910 TTGTGGTTGTTCAGAGTTGGAGG + Intergenic
941374181 2:164707015-164707037 TTGCTGCTCTTCAAATGTGCCGG + Intronic
942878330 2:180829476-180829498 CTGTGGTTCTATAAATGTGGAGG - Intergenic
943226018 2:185177646-185177668 AAGGGGTTCTTCAAATGTGTTGG - Intergenic
944327985 2:198429986-198430008 GTGTGGTTCATCAAACTTGGTGG + Intronic
947843860 2:233228032-233228054 TGGTGTTTCTCCAAATGTGATGG - Intronic
1170708545 20:18767881-18767903 TTCTGGTTCTTCACTGGTGGAGG - Intergenic
1171573101 20:26272356-26272378 TCTTGGCTGTTCAAATGTGGAGG - Intergenic
1173609557 20:44356454-44356476 TTGGGTTGCTTCCAATGTGGGGG - Intronic
1174640703 20:52041490-52041512 TTGTGGTCCTTCATCTTTGGGGG - Intergenic
1175417548 20:58811758-58811780 TTGTGGTTCCTGAAGTTTGGAGG + Intergenic
1182985813 22:34715220-34715242 TTGTGGTTATTCACATTTGTAGG - Intergenic
1183887195 22:40893999-40894021 TTTTGGCTCTTCAAAAGAGGAGG + Intronic
950851219 3:16063944-16063966 ATTTGGTTCTATAAATGTGGAGG + Intergenic
952059321 3:29488549-29488571 TAATGGTTCTTCCATTGTGGAGG + Intronic
952154168 3:30625175-30625197 TAGTGTTTCTTCAGATCTGGTGG + Intronic
952462720 3:33546075-33546097 TTGTGGTCCATTCAATGTGGTGG - Intronic
953833939 3:46327085-46327107 TTGTGGTTCTTCAGTTGTTTCGG + Intergenic
954844460 3:53543409-53543431 TTGTTGTTCTCCAAATGTGCAGG + Intronic
956070377 3:65443469-65443491 TTTTATTTCTTTAAATGTGGTGG + Intronic
957942916 3:87027576-87027598 TTGTTGTTTTTCAGATTTGGGGG + Intergenic
958081983 3:88758183-88758205 TTGAGGCTCTTCAGATGTGCAGG + Intergenic
958940071 3:100301961-100301983 TTGTGGCTCTTTAAATATTGGGG + Intronic
959860592 3:111210830-111210852 TTGCCATTCTTCAAATATGGTGG - Intronic
960775830 3:121252056-121252078 TTTTGGCTTTTAAAATGTGGAGG + Intronic
964091741 3:152885252-152885274 TTTTACTTCTCCAAATGTGGAGG - Intergenic
964136455 3:153350697-153350719 CTGTGGTTCTTCAGATGTATAGG + Intergenic
964471219 3:157058081-157058103 TTTTGATTTTTCATATGTGGGGG + Intergenic
964551256 3:157887487-157887509 GCGTGGATCTTCTAATGTGGTGG + Intergenic
967090691 3:186132559-186132581 TAATGGTTCTTCAGATCTGGGGG + Intronic
967203274 3:187094700-187094722 AAGTGTTTCTTCAAATGTGTAGG - Intergenic
970516492 4:16836238-16836260 TTGAGATTCTTCAAATGTTGAGG - Intronic
973758335 4:54096054-54096076 TTATGATTATTCAAATGTTGGGG + Intronic
974242540 4:59268825-59268847 TTGTGCTTCAGTAAATGTGGGGG - Intergenic
976120067 4:81770367-81770389 TTGCACTTCTTCAAATGTAGAGG - Intronic
979533752 4:121796436-121796458 TTATGGGTTTTCAAATGGGGAGG - Intergenic
979857742 4:125655203-125655225 TTGAGGTTGAGCAAATGTGGAGG + Intergenic
980831050 4:138129478-138129500 TTGTGCTTCTTCAGAGGTGGAGG + Intergenic
981291818 4:143085228-143085250 TTGTTGTTTTTCAAAGCTGGAGG + Intergenic
982904126 4:161047189-161047211 CTGTGTTTCTTAAAAGGTGGTGG + Intergenic
985829244 5:2215833-2215855 GTCTGGTTCTTGAAATGTGCTGG + Intergenic
986328725 5:6701920-6701942 CTGTGGTTCTTCCCGTGTGGTGG - Intergenic
987768295 5:22265069-22265091 TTGTTGTCCTTGAAATCTGGTGG - Intronic
988248799 5:28726702-28726724 TCCTGCTTCTTCAAATGTAGTGG + Intergenic
990500212 5:56389267-56389289 TTGTGAATCTTCAAGAGTGGAGG + Intergenic
990887437 5:60610612-60610634 ATGTGGTTCTACAAATGTTTAGG - Intronic
991069481 5:62460803-62460825 ATGTGATTCTAAAAATGTGGAGG - Intronic
991586954 5:68211333-68211355 TTGTGGAACTTCAAATTTGAGGG - Intergenic
992161269 5:74005586-74005608 TTGGGCTTCTTGAAATTTGGGGG + Intergenic
992221749 5:74580335-74580357 TAGTAGTTCTTCACATTTGGGGG + Intergenic
992268591 5:75042711-75042733 TCTGGGTTCTTCCAATGTGGTGG + Intergenic
992726275 5:79611041-79611063 GTGTTGGTCTGCAAATGTGGAGG - Intergenic
993179201 5:84527930-84527952 TCTTGATTCCTCAAATGTGGCGG + Intergenic
993398355 5:87418505-87418527 TAGTGGTTCTCAAACTGTGGTGG - Intergenic
993536092 5:89088035-89088057 CAGTGGTTCTTAAACTGTGGTGG + Intergenic
993813795 5:92515693-92515715 ATGTGGTGCTTCATCTGTGGTGG + Intergenic
995281191 5:110337591-110337613 TGGTGGTTAAGCAAATGTGGGGG - Intronic
996591189 5:125149532-125149554 TTGTGGTTCTTCAAATGTGGCGG - Intergenic
997728329 5:136141819-136141841 TTGGGGTTATACAAATTTGGAGG - Intronic
997856436 5:137377057-137377079 TTGTGGGTTTCCAAATGTGAGGG + Intronic
1000419342 5:161020682-161020704 TTGTGCCTCTTCAAATTTTGTGG - Intergenic
1002942543 6:1730821-1730843 TTCTGCTTCTTTAAAAGTGGGGG - Intronic
1004583620 6:16978242-16978264 CTGTGGTTCTTCATCTGTGTGGG + Intergenic
1005062281 6:21787770-21787792 TTTTGGTTCTTCAAAGGTAAGGG - Intergenic
1005261807 6:24069249-24069271 TTGTGGTTCTGGAAAAGAGGAGG - Intergenic
1008831994 6:55775888-55775910 CAGGGGTTCTTCAAATGTGGAGG + Intronic
1010507463 6:76677756-76677778 TTGTGGTTTTTCAAATGCTGTGG - Intergenic
1010880952 6:81170996-81171018 TTATTATTCTTCAAATGTGGAGG + Intergenic
1010984664 6:82410250-82410272 TTTTGTCTCTTCAAATGTGTCGG - Intergenic
1011841549 6:91507217-91507239 TTTTGTTTCTACCAATGTGGTGG - Intergenic
1011864465 6:91806272-91806294 TTGTGGATTTTCTGATGTGGTGG - Intergenic
1012816856 6:104033738-104033760 TTTTGGTTTTTCAAATTTGAAGG - Intergenic
1013040679 6:106430490-106430512 TTTTAGTTCGCCAAATGTGGGGG - Intergenic
1016703272 6:147077731-147077753 TTGTGGTTCTTCTCATGTAAAGG + Intergenic
1017104865 6:150878055-150878077 TTGTGTTTCTTCAGCTGCGGTGG + Intronic
1021117660 7:16762117-16762139 ATCTTGTTCTTGAAATGTGGTGG + Intronic
1021401582 7:20215489-20215511 TTGTAATTCTCCAAAGGTGGAGG - Intronic
1026420934 7:70236337-70236359 TTGTGATTCTTCTAGTGTGATGG + Intronic
1026703230 7:72666553-72666575 TGGTGGTTCTTTAAATGTATTGG - Intronic
1028893323 7:96013060-96013082 TTGAGGATCTTGAAATGGGGAGG + Intronic
1031000147 7:116405546-116405568 TTGTGATTCTTCCAATCTGGAGG - Intronic
1032092761 7:128919707-128919729 TTGTGGTGCTTAAAATGTGCTGG - Intergenic
1033499426 7:141933086-141933108 CTGTGGTTCTTCAAACATGATGG - Intronic
1034357003 7:150459035-150459057 TTGTGGTTCTTTATCTGGGGAGG + Intronic
1037305608 8:17500394-17500416 TTGTGGTTATGGAAATGTTGTGG + Intronic
1037678942 8:21077041-21077063 TTGTGGTTCATCATTTGTGAAGG - Intergenic
1038137879 8:24809353-24809375 TTTTGGTGCTTCAATTTTGGGGG - Intergenic
1039277210 8:35946437-35946459 TTCTGCTTCTTCAAATGTGGAGG + Intergenic
1046256416 8:111702520-111702542 GTGCGGTTCTTCACATGTGGTGG - Intergenic
1049918642 9:343136-343158 TTGTGCATCTGGAAATGTGGGGG - Intronic
1056552786 9:87664917-87664939 TTGATGTTCTTCAAAAGTGCTGG + Intronic
1057485172 9:95477267-95477289 TTGTGGCTCTTCAGCTCTGGTGG - Intronic
1058488239 9:105464621-105464643 TTGTAGTTTTTCAAAAGTGCTGG + Intronic
1061649833 9:132038604-132038626 TTATGGTTTTTCAAATGTGCAGG + Intronic
1186643577 X:11482778-11482800 TCCTGGTTCTTCACATGTGCAGG - Intronic
1187503476 X:19859531-19859553 TTGATGTTTTTCAAATTTGGGGG - Intronic
1192550799 X:72052196-72052218 TTGTGGCACTTCCAATGTGATGG + Intergenic
1193999251 X:88407288-88407310 TTCTGGTCCTCCAAATGTAGGGG - Intergenic
1194678986 X:96828507-96828529 TTGTGATTCTTCAAAGGGAGGGG - Intronic
1199524024 X:148771254-148771276 TAGTGATTCTCCAAATGTGTGGG + Intronic
1199667495 X:150111344-150111366 TTCTGGTTCTTCATATGTGTTGG + Intergenic