ID: 996592189

View in Genome Browser
Species Human (GRCh38)
Location 5:125160540-125160562
Sequence GAGAGTGAACAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996592179_996592189 24 Left 996592179 5:125160493-125160515 CCCAGTTCATCTCATTGCGACTG No data
Right 996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG No data
996592180_996592189 23 Left 996592180 5:125160494-125160516 CCAGTTCATCTCATTGCGACTGG No data
Right 996592189 5:125160540-125160562 GAGAGTGAACAGAAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996592189 Original CRISPR GAGAGTGAACAGAAGCAGGG TGG Intergenic
No off target data available for this crispr