ID: 996594798

View in Genome Browser
Species Human (GRCh38)
Location 5:125187962-125187984
Sequence AGTTTTTGGCAAAAGATGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996594792_996594798 26 Left 996594792 5:125187913-125187935 CCTGACATATGGGCTTTGGCAGA No data
Right 996594798 5:125187962-125187984 AGTTTTTGGCAAAAGATGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996594798 Original CRISPR AGTTTTTGGCAAAAGATGAC TGG Intergenic
No off target data available for this crispr