ID: 996595132

View in Genome Browser
Species Human (GRCh38)
Location 5:125192124-125192146
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996595129_996595132 1 Left 996595129 5:125192100-125192122 CCATATGTGAATGACACTGCTCC No data
Right 996595132 5:125192124-125192146 CGCTGTATATGGAGCACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr