ID: 996602356

View in Genome Browser
Species Human (GRCh38)
Location 5:125279079-125279101
Sequence TCCAATTGGATAATTCCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996602356_996602360 -6 Left 996602356 5:125279079-125279101 CCTTTTGGAATTATCCAATTGGA No data
Right 996602360 5:125279096-125279118 ATTGGACATAAAAAGGGAGCAGG No data
996602356_996602362 30 Left 996602356 5:125279079-125279101 CCTTTTGGAATTATCCAATTGGA No data
Right 996602362 5:125279132-125279154 AGCTGGATTCTTTAGTACAGAGG No data
996602356_996602361 13 Left 996602356 5:125279079-125279101 CCTTTTGGAATTATCCAATTGGA No data
Right 996602361 5:125279115-125279137 CAGGCTTAGAACTCTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996602356 Original CRISPR TCCAATTGGATAATTCCAAA AGG (reversed) Intergenic
No off target data available for this crispr