ID: 996602360

View in Genome Browser
Species Human (GRCh38)
Location 5:125279096-125279118
Sequence ATTGGACATAAAAAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996602356_996602360 -6 Left 996602356 5:125279079-125279101 CCTTTTGGAATTATCCAATTGGA No data
Right 996602360 5:125279096-125279118 ATTGGACATAAAAAGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996602360 Original CRISPR ATTGGACATAAAAAGGGAGC AGG Intergenic
No off target data available for this crispr