ID: 996602361

View in Genome Browser
Species Human (GRCh38)
Location 5:125279115-125279137
Sequence CAGGCTTAGAACTCTGTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996602356_996602361 13 Left 996602356 5:125279079-125279101 CCTTTTGGAATTATCCAATTGGA No data
Right 996602361 5:125279115-125279137 CAGGCTTAGAACTCTGTAGCTGG No data
996602359_996602361 -1 Left 996602359 5:125279093-125279115 CCAATTGGACATAAAAAGGGAGC No data
Right 996602361 5:125279115-125279137 CAGGCTTAGAACTCTGTAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996602361 Original CRISPR CAGGCTTAGAACTCTGTAGC TGG Intergenic
No off target data available for this crispr