ID: 996608750

View in Genome Browser
Species Human (GRCh38)
Location 5:125354446-125354468
Sequence CTAGTCCTGGACCTATTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996608747_996608750 3 Left 996608747 5:125354420-125354442 CCAATAGAATTCAGTTGTGAATC No data
Right 996608750 5:125354446-125354468 CTAGTCCTGGACCTATTTGTTGG No data
996608745_996608750 22 Left 996608745 5:125354401-125354423 CCAATTCCTCTTTGAATGTCCAA No data
Right 996608750 5:125354446-125354468 CTAGTCCTGGACCTATTTGTTGG No data
996608746_996608750 16 Left 996608746 5:125354407-125354429 CCTCTTTGAATGTCCAATAGAAT No data
Right 996608750 5:125354446-125354468 CTAGTCCTGGACCTATTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996608750 Original CRISPR CTAGTCCTGGACCTATTTGT TGG Intergenic
No off target data available for this crispr