ID: 996614895

View in Genome Browser
Species Human (GRCh38)
Location 5:125429526-125429548
Sequence GTGCTTCTCAGTGAGTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996614895_996614897 5 Left 996614895 5:125429526-125429548 CCACAGCACTCACTGAGAAGCAC No data
Right 996614897 5:125429554-125429576 GAGAGAAGAAAGAATGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996614895 Original CRISPR GTGCTTCTCAGTGAGTGCTG TGG (reversed) Intergenic
No off target data available for this crispr