ID: 996615483

View in Genome Browser
Species Human (GRCh38)
Location 5:125436216-125436238
Sequence CATTATCTGCTGGGTGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996615483_996615492 29 Left 996615483 5:125436216-125436238 CCCTGTACACCCAGCAGATAATG No data
Right 996615492 5:125436268-125436290 AATATACTTTCATTCAAAAAGGG No data
996615483_996615489 -4 Left 996615483 5:125436216-125436238 CCCTGTACACCCAGCAGATAATG No data
Right 996615489 5:125436235-125436257 AATGATCATGGGATAGTCCTAGG No data
996615483_996615493 30 Left 996615483 5:125436216-125436238 CCCTGTACACCCAGCAGATAATG No data
Right 996615493 5:125436269-125436291 ATATACTTTCATTCAAAAAGGGG No data
996615483_996615491 28 Left 996615483 5:125436216-125436238 CCCTGTACACCCAGCAGATAATG No data
Right 996615491 5:125436267-125436289 AAATATACTTTCATTCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996615483 Original CRISPR CATTATCTGCTGGGTGTACA GGG (reversed) Intergenic
No off target data available for this crispr