ID: 996618215

View in Genome Browser
Species Human (GRCh38)
Location 5:125467506-125467528
Sequence TGTTACTATAGCCATTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996618209_996618215 25 Left 996618209 5:125467458-125467480 CCAGGAAAATGCCATTGTTCACC No data
Right 996618215 5:125467506-125467528 TGTTACTATAGCCATTGGTCTGG No data
996618208_996618215 26 Left 996618208 5:125467457-125467479 CCCAGGAAAATGCCATTGTTCAC No data
Right 996618215 5:125467506-125467528 TGTTACTATAGCCATTGGTCTGG No data
996618211_996618215 14 Left 996618211 5:125467469-125467491 CCATTGTTCACCAATTAGGTAAT No data
Right 996618215 5:125467506-125467528 TGTTACTATAGCCATTGGTCTGG No data
996618212_996618215 4 Left 996618212 5:125467479-125467501 CCAATTAGGTAATAAAAACCTGA No data
Right 996618215 5:125467506-125467528 TGTTACTATAGCCATTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996618215 Original CRISPR TGTTACTATAGCCATTGGTC TGG Intergenic
No off target data available for this crispr