ID: 996619528

View in Genome Browser
Species Human (GRCh38)
Location 5:125483238-125483260
Sequence CAGTAGGTACATGTTGTAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996619525_996619528 20 Left 996619525 5:125483195-125483217 CCATGGGAAATTAAGCCACATAT No data
Right 996619528 5:125483238-125483260 CAGTAGGTACATGTTGTAAAAGG No data
996619526_996619528 5 Left 996619526 5:125483210-125483232 CCACATATATCATTTTGTATTTA No data
Right 996619528 5:125483238-125483260 CAGTAGGTACATGTTGTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996619528 Original CRISPR CAGTAGGTACATGTTGTAAA AGG Intergenic
No off target data available for this crispr