ID: 996624208

View in Genome Browser
Species Human (GRCh38)
Location 5:125550563-125550585
Sequence AACTCCATGCTGTTAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996624206_996624208 -5 Left 996624206 5:125550545-125550567 CCAGCAACCATTGTGAGTAACTC No data
Right 996624208 5:125550563-125550585 AACTCCATGCTGTTAAAAAGTGG No data
996624201_996624208 24 Left 996624201 5:125550516-125550538 CCTGAAAAGTCCCCTCTGGATGA No data
Right 996624208 5:125550563-125550585 AACTCCATGCTGTTAAAAAGTGG No data
996624204_996624208 12 Left 996624204 5:125550528-125550550 CCTCTGGATGACCAACACCAGCA No data
Right 996624208 5:125550563-125550585 AACTCCATGCTGTTAAAAAGTGG No data
996624205_996624208 1 Left 996624205 5:125550539-125550561 CCAACACCAGCAACCATTGTGAG No data
Right 996624208 5:125550563-125550585 AACTCCATGCTGTTAAAAAGTGG No data
996624203_996624208 13 Left 996624203 5:125550527-125550549 CCCTCTGGATGACCAACACCAGC No data
Right 996624208 5:125550563-125550585 AACTCCATGCTGTTAAAAAGTGG No data
996624202_996624208 14 Left 996624202 5:125550526-125550548 CCCCTCTGGATGACCAACACCAG No data
Right 996624208 5:125550563-125550585 AACTCCATGCTGTTAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996624208 Original CRISPR AACTCCATGCTGTTAAAAAG TGG Intergenic
No off target data available for this crispr