ID: 996625438

View in Genome Browser
Species Human (GRCh38)
Location 5:125564805-125564827
Sequence CTGAAAACATCATTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996625438_996625441 4 Left 996625438 5:125564805-125564827 CCCTGCTCCAATGATGTTTTCAG No data
Right 996625441 5:125564832-125564854 TGAAATCTGTTTTGTGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996625438 Original CRISPR CTGAAAACATCATTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr