ID: 996627990

View in Genome Browser
Species Human (GRCh38)
Location 5:125593184-125593206
Sequence ACAATGAATCTTGTGTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996627987_996627990 -10 Left 996627987 5:125593171-125593193 CCAACACAAGTCCACAATGAATC No data
Right 996627990 5:125593184-125593206 ACAATGAATCTTGTGTAAGGAGG No data
996627985_996627990 20 Left 996627985 5:125593141-125593163 CCACTTCTAGATATATTCAATGT No data
Right 996627990 5:125593184-125593206 ACAATGAATCTTGTGTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996627990 Original CRISPR ACAATGAATCTTGTGTAAGG AGG Intergenic