ID: 996631661

View in Genome Browser
Species Human (GRCh38)
Location 5:125640013-125640035
Sequence CAGGCTGCACCCTCTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996631661_996631662 -9 Left 996631661 5:125640013-125640035 CCAAGATCAGAGGGTGCAGCCTG No data
Right 996631662 5:125640027-125640049 TGCAGCCTGAATGTGAGTATAGG No data
996631661_996631664 16 Left 996631661 5:125640013-125640035 CCAAGATCAGAGGGTGCAGCCTG No data
Right 996631664 5:125640052-125640074 TTTACCACAAATTCTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996631661 Original CRISPR CAGGCTGCACCCTCTGATCT TGG (reversed) Intergenic
No off target data available for this crispr