ID: 996631662

View in Genome Browser
Species Human (GRCh38)
Location 5:125640027-125640049
Sequence TGCAGCCTGAATGTGAGTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996631656_996631662 12 Left 996631656 5:125639992-125640014 CCACTTTCAGCATCTATCTCCCC No data
Right 996631662 5:125640027-125640049 TGCAGCCTGAATGTGAGTATAGG No data
996631659_996631662 -7 Left 996631659 5:125640011-125640033 CCCCAAGATCAGAGGGTGCAGCC No data
Right 996631662 5:125640027-125640049 TGCAGCCTGAATGTGAGTATAGG No data
996631655_996631662 13 Left 996631655 5:125639991-125640013 CCCACTTTCAGCATCTATCTCCC No data
Right 996631662 5:125640027-125640049 TGCAGCCTGAATGTGAGTATAGG No data
996631660_996631662 -8 Left 996631660 5:125640012-125640034 CCCAAGATCAGAGGGTGCAGCCT No data
Right 996631662 5:125640027-125640049 TGCAGCCTGAATGTGAGTATAGG No data
996631661_996631662 -9 Left 996631661 5:125640013-125640035 CCAAGATCAGAGGGTGCAGCCTG No data
Right 996631662 5:125640027-125640049 TGCAGCCTGAATGTGAGTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996631662 Original CRISPR TGCAGCCTGAATGTGAGTAT AGG Intergenic
No off target data available for this crispr