ID: 996631664

View in Genome Browser
Species Human (GRCh38)
Location 5:125640052-125640074
Sequence TTTACCACAAATTCTTTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996631663_996631664 -3 Left 996631663 5:125640032-125640054 CCTGAATGTGAGTATAGGCATTT No data
Right 996631664 5:125640052-125640074 TTTACCACAAATTCTTTCTCTGG No data
996631661_996631664 16 Left 996631661 5:125640013-125640035 CCAAGATCAGAGGGTGCAGCCTG No data
Right 996631664 5:125640052-125640074 TTTACCACAAATTCTTTCTCTGG No data
996631660_996631664 17 Left 996631660 5:125640012-125640034 CCCAAGATCAGAGGGTGCAGCCT No data
Right 996631664 5:125640052-125640074 TTTACCACAAATTCTTTCTCTGG No data
996631659_996631664 18 Left 996631659 5:125640011-125640033 CCCCAAGATCAGAGGGTGCAGCC No data
Right 996631664 5:125640052-125640074 TTTACCACAAATTCTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996631664 Original CRISPR TTTACCACAAATTCTTTCTC TGG Intergenic
No off target data available for this crispr