ID: 996633472

View in Genome Browser
Species Human (GRCh38)
Location 5:125664612-125664634
Sequence ATCAGATGGCTCCTATAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996633472_996633477 7 Left 996633472 5:125664612-125664634 CCAGTCTATAGGAGCCATCTGAT No data
Right 996633477 5:125664642-125664664 TTGGGAGAATAGGAGTATTGTGG No data
996633472_996633483 21 Left 996633472 5:125664612-125664634 CCAGTCTATAGGAGCCATCTGAT No data
Right 996633483 5:125664656-125664678 GTATTGTGGGGAGAATGGGTGGG No data
996633472_996633484 22 Left 996633472 5:125664612-125664634 CCAGTCTATAGGAGCCATCTGAT No data
Right 996633484 5:125664657-125664679 TATTGTGGGGAGAATGGGTGGGG No data
996633472_996633479 9 Left 996633472 5:125664612-125664634 CCAGTCTATAGGAGCCATCTGAT No data
Right 996633479 5:125664644-125664666 GGGAGAATAGGAGTATTGTGGGG No data
996633472_996633476 -3 Left 996633472 5:125664612-125664634 CCAGTCTATAGGAGCCATCTGAT No data
Right 996633476 5:125664632-125664654 GATTTTTTAATTGGGAGAATAGG No data
996633472_996633482 20 Left 996633472 5:125664612-125664634 CCAGTCTATAGGAGCCATCTGAT No data
Right 996633482 5:125664655-125664677 AGTATTGTGGGGAGAATGGGTGG No data
996633472_996633481 17 Left 996633472 5:125664612-125664634 CCAGTCTATAGGAGCCATCTGAT No data
Right 996633481 5:125664652-125664674 AGGAGTATTGTGGGGAGAATGGG No data
996633472_996633480 16 Left 996633472 5:125664612-125664634 CCAGTCTATAGGAGCCATCTGAT No data
Right 996633480 5:125664651-125664673 TAGGAGTATTGTGGGGAGAATGG No data
996633472_996633478 8 Left 996633472 5:125664612-125664634 CCAGTCTATAGGAGCCATCTGAT No data
Right 996633478 5:125664643-125664665 TGGGAGAATAGGAGTATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996633472 Original CRISPR ATCAGATGGCTCCTATAGAC TGG (reversed) Intergenic