ID: 996637274

View in Genome Browser
Species Human (GRCh38)
Location 5:125708629-125708651
Sequence TAGTAGGCTTAGAGTAGTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996637271_996637274 18 Left 996637271 5:125708588-125708610 CCTTCTCATGCTTGAGGAAGAAC No data
Right 996637274 5:125708629-125708651 TAGTAGGCTTAGAGTAGTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996637274 Original CRISPR TAGTAGGCTTAGAGTAGTAG CGG Intergenic
No off target data available for this crispr