ID: 996647070

View in Genome Browser
Species Human (GRCh38)
Location 5:125829069-125829091
Sequence ACTTGGATATTGTGTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996647070_996647077 26 Left 996647070 5:125829069-125829091 CCTTCAGGACACAATATCCAAGT No data
Right 996647077 5:125829118-125829140 CAGAAGAGACACTCAGAGGCTGG No data
996647070_996647075 22 Left 996647070 5:125829069-125829091 CCTTCAGGACACAATATCCAAGT No data
Right 996647075 5:125829114-125829136 CTGCCAGAAGAGACACTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996647070 Original CRISPR ACTTGGATATTGTGTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr