ID: 996649168

View in Genome Browser
Species Human (GRCh38)
Location 5:125852579-125852601
Sequence TTTCTATTCTTAACATACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996649160_996649168 25 Left 996649160 5:125852531-125852553 CCTAAGATCACCATCCCCAAATT No data
Right 996649168 5:125852579-125852601 TTTCTATTCTTAACATACCCTGG No data
996649164_996649168 10 Left 996649164 5:125852546-125852568 CCCAAATTCTTTTAAGTTTGGCC No data
Right 996649168 5:125852579-125852601 TTTCTATTCTTAACATACCCTGG No data
996649161_996649168 15 Left 996649161 5:125852541-125852563 CCATCCCCAAATTCTTTTAAGTT No data
Right 996649168 5:125852579-125852601 TTTCTATTCTTAACATACCCTGG No data
996649165_996649168 9 Left 996649165 5:125852547-125852569 CCAAATTCTTTTAAGTTTGGCCT No data
Right 996649168 5:125852579-125852601 TTTCTATTCTTAACATACCCTGG No data
996649163_996649168 11 Left 996649163 5:125852545-125852567 CCCCAAATTCTTTTAAGTTTGGC No data
Right 996649168 5:125852579-125852601 TTTCTATTCTTAACATACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996649168 Original CRISPR TTTCTATTCTTAACATACCC TGG Intergenic
No off target data available for this crispr