ID: 996649955

View in Genome Browser
Species Human (GRCh38)
Location 5:125863763-125863785
Sequence TGCCGTAACCATAGTGTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996649953_996649955 5 Left 996649953 5:125863735-125863757 CCTTTAATCCTTCTCTTTTTAGA No data
Right 996649955 5:125863763-125863785 TGCCGTAACCATAGTGTAGTAGG No data
996649952_996649955 24 Left 996649952 5:125863716-125863738 CCTTTCATTTTACGCAAAGCCTT No data
Right 996649955 5:125863763-125863785 TGCCGTAACCATAGTGTAGTAGG No data
996649954_996649955 -3 Left 996649954 5:125863743-125863765 CCTTCTCTTTTTAGATAAAATGC No data
Right 996649955 5:125863763-125863785 TGCCGTAACCATAGTGTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996649955 Original CRISPR TGCCGTAACCATAGTGTAGT AGG Intergenic
No off target data available for this crispr