ID: 996653715

View in Genome Browser
Species Human (GRCh38)
Location 5:125913992-125914014
Sequence AGGAAGAGCTCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996653715_996653722 26 Left 996653715 5:125913992-125914014 CCCACAATCACTGAGCTCTTCCT No data
Right 996653722 5:125914041-125914063 ATGCCATATGGCCACTGCTATGG No data
996653715_996653721 14 Left 996653715 5:125913992-125914014 CCCACAATCACTGAGCTCTTCCT No data
Right 996653721 5:125914029-125914051 AGTTATTGTTTAATGCCATATGG No data
996653715_996653723 27 Left 996653715 5:125913992-125914014 CCCACAATCACTGAGCTCTTCCT No data
Right 996653723 5:125914042-125914064 TGCCATATGGCCACTGCTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996653715 Original CRISPR AGGAAGAGCTCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr