ID: 996655737

View in Genome Browser
Species Human (GRCh38)
Location 5:125933743-125933765
Sequence CTTTCTATGCAGCAAGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996655735_996655737 8 Left 996655735 5:125933712-125933734 CCATTGGAAAACTCATCATCTTA No data
Right 996655737 5:125933743-125933765 CTTTCTATGCAGCAAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996655737 Original CRISPR CTTTCTATGCAGCAAGTGGC AGG Intergenic
No off target data available for this crispr