ID: 996659856

View in Genome Browser
Species Human (GRCh38)
Location 5:125988954-125988976
Sequence AGGGACAGCAAAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996659856_996659865 15 Left 996659856 5:125988954-125988976 CCCACAATCACTTTGCTGTCCCT No data
Right 996659865 5:125988992-125989014 ATTCTCTTTCCGTGCTGCTGGGG No data
996659856_996659866 16 Left 996659856 5:125988954-125988976 CCCACAATCACTTTGCTGTCCCT No data
Right 996659866 5:125988993-125989015 TTCTCTTTCCGTGCTGCTGGGGG No data
996659856_996659868 21 Left 996659856 5:125988954-125988976 CCCACAATCACTTTGCTGTCCCT No data
Right 996659868 5:125988998-125989020 TTTCCGTGCTGCTGGGGGCTGGG No data
996659856_996659870 26 Left 996659856 5:125988954-125988976 CCCACAATCACTTTGCTGTCCCT No data
Right 996659870 5:125989003-125989025 GTGCTGCTGGGGGCTGGGTGAGG No data
996659856_996659871 27 Left 996659856 5:125988954-125988976 CCCACAATCACTTTGCTGTCCCT No data
Right 996659871 5:125989004-125989026 TGCTGCTGGGGGCTGGGTGAGGG No data
996659856_996659867 20 Left 996659856 5:125988954-125988976 CCCACAATCACTTTGCTGTCCCT No data
Right 996659867 5:125988997-125989019 CTTTCCGTGCTGCTGGGGGCTGG No data
996659856_996659864 14 Left 996659856 5:125988954-125988976 CCCACAATCACTTTGCTGTCCCT No data
Right 996659864 5:125988991-125989013 GATTCTCTTTCCGTGCTGCTGGG No data
996659856_996659863 13 Left 996659856 5:125988954-125988976 CCCACAATCACTTTGCTGTCCCT No data
Right 996659863 5:125988990-125989012 AGATTCTCTTTCCGTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996659856 Original CRISPR AGGGACAGCAAAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr