ID: 996660400

View in Genome Browser
Species Human (GRCh38)
Location 5:125996153-125996175
Sequence TGTTATAAGGACATGGTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996660400_996660405 25 Left 996660400 5:125996153-125996175 CCATAAACCATGTCCTTATAACA No data
Right 996660405 5:125996201-125996223 GGTGTGTTCTGACTGCTCCATGG No data
996660400_996660404 4 Left 996660400 5:125996153-125996175 CCATAAACCATGTCCTTATAACA No data
Right 996660404 5:125996180-125996202 GAACTTCATCAATAAATGTTGGG No data
996660400_996660403 3 Left 996660400 5:125996153-125996175 CCATAAACCATGTCCTTATAACA No data
Right 996660403 5:125996179-125996201 TGAACTTCATCAATAAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996660400 Original CRISPR TGTTATAAGGACATGGTTTA TGG (reversed) Intergenic
No off target data available for this crispr