ID: 996662714

View in Genome Browser
Species Human (GRCh38)
Location 5:126023004-126023026
Sequence CTGAATATACAAATGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996662714_996662715 24 Left 996662714 5:126023004-126023026 CCATTTTTCATTTGTATATTCAG No data
Right 996662715 5:126023051-126023073 ACCAACAATCCAATGCTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996662714 Original CRISPR CTGAATATACAAATGAAAAA TGG (reversed) Intergenic
No off target data available for this crispr