ID: 996662883

View in Genome Browser
Species Human (GRCh38)
Location 5:126025719-126025741
Sequence TGGCTCCTTGGCTGATGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996662883_996662887 0 Left 996662883 5:126025719-126025741 CCAGGGCATCAGCCAAGGAGCCA No data
Right 996662887 5:126025742-126025764 GGAGACAGAGCCAAAAAGTTTGG No data
996662883_996662889 18 Left 996662883 5:126025719-126025741 CCAGGGCATCAGCCAAGGAGCCA No data
Right 996662889 5:126025760-126025782 TTTGGAATAGTTCTCACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996662883 Original CRISPR TGGCTCCTTGGCTGATGCCC TGG (reversed) Intergenic
No off target data available for this crispr