ID: 996665066

View in Genome Browser
Species Human (GRCh38)
Location 5:126049646-126049668
Sequence CCAAGGCTCCACCCCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996665066_996665072 1 Left 996665066 5:126049646-126049668 CCCACACTGGGGTGGAGCCTTGG No data
Right 996665072 5:126049670-126049692 AAGTTTGTGCCCTTTGTAGTGGG No data
996665066_996665071 0 Left 996665066 5:126049646-126049668 CCCACACTGGGGTGGAGCCTTGG No data
Right 996665071 5:126049669-126049691 GAAGTTTGTGCCCTTTGTAGTGG No data
996665066_996665073 2 Left 996665066 5:126049646-126049668 CCCACACTGGGGTGGAGCCTTGG No data
Right 996665073 5:126049671-126049693 AGTTTGTGCCCTTTGTAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996665066 Original CRISPR CCAAGGCTCCACCCCAGTGT GGG (reversed) Intergenic