ID: 996670456

View in Genome Browser
Species Human (GRCh38)
Location 5:126112177-126112199
Sequence TGACATCGATGGGTTTATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996670449_996670456 21 Left 996670449 5:126112133-126112155 CCGGTCTTTCCCATGCTATTCTT No data
Right 996670456 5:126112177-126112199 TGACATCGATGGGTTTATCAGGG No data
996670451_996670456 12 Left 996670451 5:126112142-126112164 CCCATGCTATTCTTGTGCTGGTG No data
Right 996670456 5:126112177-126112199 TGACATCGATGGGTTTATCAGGG No data
996670452_996670456 11 Left 996670452 5:126112143-126112165 CCATGCTATTCTTGTGCTGGTGA No data
Right 996670456 5:126112177-126112199 TGACATCGATGGGTTTATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996670456 Original CRISPR TGACATCGATGGGTTTATCA GGG Intergenic