ID: 996670456 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:126112177-126112199 |
| Sequence | TGACATCGATGGGTTTATCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 996670449_996670456 | 21 | Left | 996670449 | 5:126112133-126112155 | CCGGTCTTTCCCATGCTATTCTT | No data | ||
| Right | 996670456 | 5:126112177-126112199 | TGACATCGATGGGTTTATCAGGG | No data | ||||
| 996670451_996670456 | 12 | Left | 996670451 | 5:126112142-126112164 | CCCATGCTATTCTTGTGCTGGTG | No data | ||
| Right | 996670456 | 5:126112177-126112199 | TGACATCGATGGGTTTATCAGGG | No data | ||||
| 996670452_996670456 | 11 | Left | 996670452 | 5:126112143-126112165 | CCATGCTATTCTTGTGCTGGTGA | No data | ||
| Right | 996670456 | 5:126112177-126112199 | TGACATCGATGGGTTTATCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 996670456 | Original CRISPR | TGACATCGATGGGTTTATCA GGG | Intergenic | ||