ID: 996670892

View in Genome Browser
Species Human (GRCh38)
Location 5:126115572-126115594
Sequence CTGAATATACAAATGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996670892_996670895 21 Left 996670892 5:126115572-126115594 CCACTGTCCATTTGTATATTCAG No data
Right 996670895 5:126115616-126115638 GAACTTTCTGCCCTCTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996670892 Original CRISPR CTGAATATACAAATGGACAG TGG (reversed) Intergenic
No off target data available for this crispr