ID: 996673425

View in Genome Browser
Species Human (GRCh38)
Location 5:126147258-126147280
Sequence CAGTAAATACTGATGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996673417_996673425 14 Left 996673417 5:126147221-126147243 CCCAGTTCCTAACACAGACCTGG No data
Right 996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG No data
996673419_996673425 13 Left 996673419 5:126147222-126147244 CCAGTTCCTAACACAGACCTGGC No data
Right 996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG No data
996673420_996673425 7 Left 996673420 5:126147228-126147250 CCTAACACAGACCTGGCACCCAT No data
Right 996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG No data
996673421_996673425 -4 Left 996673421 5:126147239-126147261 CCTGGCACCCATAAGCACTCAGT No data
Right 996673425 5:126147258-126147280 CAGTAAATACTGATGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996673425 Original CRISPR CAGTAAATACTGATGAAGGA AGG Intergenic
No off target data available for this crispr